Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1l24
Contig Information
Length 186 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1l24   
Homology (BLAST) Top Hit 26S proteasome non-ATPase regulatory subunit 14 [Zea mays]
Score 240
Evalue 4.5105e-19
Total Hit Count 289
Registered year 2003
Contig Sequence     [ Download ]
>whem1l24
CGGATCTTCGGCGCCGGCGGGATGGGCCAGCCGCCGTCGGACTCGCCGCTGCTCGACTCCTCCGAGCAGGTCTACATCTCGTCCCTCGCCCTCCTCAAGA
TGCTCAAGCACGGGAGGGCCGGCGTGCCGATGGAGGTCATGGGCCTCATGCTCGGCGAGTTCGTCGACGACTACACGGTCCGGGTG
page-top