Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1l23
Contig Information
Length 614 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1l23   
Homology (BLAST) Top Hit hypothetical protein OsI_22252 [Oryza sativa Indica Group]
Score 613
Evalue 2.57448e-63
Total Hit Count 51
Registered year 2003
Contig Sequence     [ Download ]
>whem1l23
CATAGTAGTCCCAGGGTGCTTCGATCTACCCCTAAAAACAAGAGCAAGACACCTAAAAAGCAAGTAAATTCATTGAGGTCCGCACATAGTAGTGCCAGGG
TGCTTAGCTCTACCTTGAAGAAAAAGGTACCTAATGAGCCAGTAAACAACAGTACTGCTGCTCAACCAGCTGCCAGGAAAAGGAAAAGAGGCAGGCCCTC
AAATGCAGCGAGTCCCAAGAATGAGTGCATCAAAATTCGCCAACGAGTTAGATACATTTTGAATCGAATGAACTACGAACAAAGTTTCATTCAAGCCTAT
GCTGGTGAAGGTTGGAAAGGTCAAAGTTTGGAAAAAATAAGACCTGAGAAAGAGCTTGAGCGAGCCAAGGCAGAAATCTTGCGATGCAAGTTAAGAATTC
GGGAAGCTTTTCGTAATATGGATTCTCTTCTATTGGAGGGGAAGCTTGACGAATCTTTGTTTGATTCTGAGGGAGAAATATCTAGTGAAGATATTTTCTG
TGCCATTTGTGCTTCAAAGCATGTTACGCTAAAAAATGATATCATTCTTTGCGATGGAGTGTGTGATANAGGATTCCCCANAAATGTTTGAATCCTCCTT
TGCTGGCNGAAGAT
page-top