Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6l19
Contig Information
Length 409 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6l19   
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_159818 [Branchiostoma floridae] >gi|210092856|gb|EEA41073.1| hypothetical protein BRAFLDRAFT_159818 [Branchiostoma floridae]
Score 84
Evalue 0.542884
Total Hit Count 42
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6l19
ATACGCTGTATACCATGCATAGCGCTAACCCTTATGTACACGCCAAAATCAGGCACAGCTGATTTTGGAACAAGCTTACCACCCACTGCCACCACCATTG
CCGGCATCCCCGCCCTTGTTGCTGTCCCATCCGCCACTGGCCACCTTGTCCCAAGAACTGCCGCCACCTCCGCCTTGGCTCCCGCTCCCTTCAGCCTTGT
CCCAGGATCCTTCCTTCTTCGAACCACCTTCTGAGCCTCCAGTTCCTTTTGAAGAATTCCAGCTATCTTCATTGCTCTTTCCCCATGATCCTCCTCCGCC
TGCAGATCCTCCAGTACCAGCGGTGGCGCCGCCAGCAGGAGCCCACTGGCCCAGGATAGAGGATCCATCGCCAGAAAATGGCTTGTTTTGACTCCAGGTG
TTGTTTCCA
page-top