Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1l11
Contig Information
Length 144 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1l11   
Homology (BLAST) Top Hit magnesium chelatase D subunit [Arthrospira platensis]
Score 77
Evalue 3.47374
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whem1l11
CATCAGGTGCGTCGAGTTTTAGGAGCTGGTAGAACGCAGAGCCACAACTGGTTCGGTTGTTCCTGATCCCTGGGACATGGATGAGCTCCAAGACTCGGAA
CCGGCCATCGATCCACCCCAGGAGGAGGAGGAAGATGTTATCGT
page-top