Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1887
Contig Information
Length 993 bp
Tissue Callus
Clones 6 Clones [Download: CSV  ,  FASTA ]
whcs10b20    whcs9j10    whcs9j21    rwhcs10b20    rwhcs9j10    rwhcs9j21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATP synthase delta chain [Zea mays] >gi|219887163|gb|ACL53956.1| unknown [Zea mays]
Score 732
Evalue 1.89501e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1887
TTCCTCCTCTCCCCGACCCGATCTCCTCCTAGGTTTCGCTCTCCACCACCGCGGAACGAACCGGAAATGGCGGCGCGGCACCTCAGATCCGGCCTCCCGC
TCCTCCAAGCTCGCCTCGCGGCCAACGAATCCGCGGCCGTCGCTCAGGTATCGAGGGGGCTGGCAACGGAGGCGGATAAGCCTAAGGAGAACAAGATCAA
GGTTCCAAAAGCTCTGTATGGTGGCACCGGCAACTATGCTAGTGCGTTGTTCCTTGCAGCAGCCAACGCAAATTCGTTGGAAAAAGTTGAATCCGAGATT
CTCGATGTTGTAGGGGCATCCAAGAAGAGCCCTATGTTTTCTCAATTCATGAAGGACACATCAGTGCCTAAAGAAACCAGGGTGAAGGCTATAACTGAAA
TATTCTCTGAAGCCGGGTTTACTGACATCACAAAGAAATTCTTGTCTGCACTGGCATCCAATGGAAGACTGAAATATGTTGAGCGCATTGCTGAGAGATT
TGTTGATTTGACCATGGCACATAGGGGGGAGGTGAAAGTTGTTGTCAGGACTGTTGTTCCACTTCCTGATAAGGAGGAGAAAGAACTTAAGGAGACCTTG
CGTGATATCCTTGGGAAAGACAAAACCATCTTGGTTGAACAAAAGATTGACCAGAGTATCATGGGAGGACTGGTGATTGAATTTGGGCAGAAGGTGTTTG
ACATGTCGATCAAGACTAGGGCGAAGCAAATGGAGGCATTCTTGAGACTACCCTTTGACATCTAACCGCCTTCGGATCTAAATCAACACCAGAGTGCAGT
GGCTGAGCCGCTGAAGGTTCCCTCATGTCTGCTTCTTCGATGTGGTCTTGAAATAAAAGCTTACCTTTACAAGAGAACGACACTCTGTTTTATTTTGTCT
TGTGGGTTAGGAAGAAGCCCGCTGAACAATCTTTAATTTCCTTTCTGCCAAAAAACATGGATAAAAACCATGAGGAGAGGTCCATGGAAAGTT
page-top