Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1l06
Contig Information
Length 346 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1l06   
Homology (BLAST) Top Hit Os05g0350600 [Oryza sativa (japonica cultivar-group)] >gi|113578826|dbj|BAF17189.1| Os05g0350600 [Oryza sativa (japonica cultivar-group)]
Score 325
Evalue 6.25561e-29
Total Hit Count 439
Registered year 2003
Contig Sequence     [ Download ]
>whem1l06
AGCGCGCCGCGGCCCAACCCTTCCGATGGCGGACAAGGAGCCCGTCGTGGAGCGCCCCGTCGCGGAGGAGGAAGGCGAGGACTCCGCTGCCGCGGCCGCC
GCCGGCGAGGAGGAGGACACCGGTGCCCAGGTCGCCCCCATCGTGCGGCTCGAGGAGGTCGCCGTCACCACCGGCGAGGAGGACGAGGACTCTCTCCTCG
ACATGAAGGCGAAGCTATACAGGTTCGACAAGGATGGGAACCANTGGAAGGANAGGGGNACGGNCACCGTCAAGCTGCTCAAGCATAAGGAGAACGGCNA
GGTCCGCCTTGTTATGCNCCAGGCCAANANACTTAATATCTGCNNC
page-top