Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1l04
Contig Information
Length 169 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1l04   
Homology (BLAST) Top Hit tenascin [Culex quinquefasciatus] >gi|167878262|gb|EDS41645.1| tenascin [Culex quinquefasciatus]
Score 74
Evalue 7.83744
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whem1l04
ATTATTGTATTGACATATCTGAAAGTATTCTACTGACATATCTGAGAATTTTAATGATCTACCAGCAACTAGGTGTTAAGCTTCAGGCTGGGTGCATGTT
TCTTTTTGTCGGAAACAAAACAGTGCAGGCTCGTGCACCTGTTTTCCTTTTCCCCTTCGATGGGGTCGT
page-top