Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem14l04
Contig Information
Length 430 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem14l04   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 175
Evalue 1.52771e-11
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>whem14l04
CGCCGCCGTTCGCGCCGCCAGGCCCAGTCTGCCCCCGCTCGCCGGNCGGAATCTCTCCTCAGCTGACAGATCCGGCCGTCCAAGGCTGACTCCCGCCGGA
TCCCGATCCTCGGCGCCGCCAGTCGCGCGGGGTGGGAGGAGCTGCGACACCATGGCATAGAGGAGCTAGGCCCGACGCCGTTGACGCCCATCCCGAGCCA
GGAGAANCACCAGGACGACCGCTCTTCTTCCCCGTCCCGAGCAAGATAAACATATAATCTTAATGGGGCATGATAATATCACTCATATAGAGAAGCTCAC
GGCGGATGGTTCCATTGCTGACAGGAAATGTTGCCAGGAACCTGGCTGCGATGAGATTGTCAGTGGAAGGGTAATGTACTGCAGTANTCACACTAGAGGG
CATTCATCCCAACAGCTTGGTTACCTCCAG
page-top