Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem14k16
Contig Information
Length 650 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem14k16   
Homology (BLAST) Top Hit hypothetical protein OsJ_002250 [Oryza sativa (japonica cultivar-group)]
Score 1008
Evalue 8.57283e-108
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>whem14k16
CATCGGAGGGAGTGGCTTTGTTGAATGCATCAGAGAGCACATTCATTCTGGTTGGCAATGCCGCTTGACTGATGAGCAGTTTATTGCTGTAAAAGAACTG
CTTAAAACGGCTATAACTCTTGCTAGCTCTCGCGATGATGTGTCAACCATTAGAGATGCTCTTGAAGTTTCTGCTGAAATGTACAGGAAGGACCCAAACA
ATGTTCAAGACTATGTCCAGCGTCATCTGTTATCCCTATCAGTCTGGGAGGAGCTTCGCTTCTGGGATGGCTACTTTGAATATTTGATGGAAAACTGTTC
GAACAAGTCGACAAATTATGTAACATTAGTTACTGCACAGCTCATTGTCATGGCAACTCACATGGCTGGATTGGGACTACCTGATATTGATTCTTGGAAT
ATGATCGAGAAAATAGCAGAGAGAAACAACTTAGGTTATAAGCAGCTTATCAAACTTAGAGCATTGCTCACACATCTGCAACAACTTCGTGTTGGCTATT
GGGGGGTCCCTATAGGAAAAGGCCAACCACTGCCATCATATAGCATGGCTTCCCCTCGTGCGCTTGATATATCTGATGAAAGCGAACAACCTGCTGAGGC
ATCCGTGTTANGCCGAAGTTGGGTGCACAGTATGTTCANNTANGGACAGA
page-top