Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1k15
Contig Information
Length 161 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1k15   
Homology (BLAST) Top Hit actin-1 [Zea mays]
Score 85
Evalue 0.419532
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>whem1k15
TATTCCTTCCTTCGTCTCGCCGCAGTCCACCTCGCTTCATCCGCCGAGCAGAGCCCTCCAGACGCCATCCACGCTCCCGTGAACAGATTTCTTACAGGAA
ACTTGACAAATGGCTGATGAGGATGTTCAACCTATCGTGTGCGATANCGGCACTGGAATGG
page-top