Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1k13
Contig Information
Length 203 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1k13   
Homology (BLAST) Top Hit hypothetical protein [Cryptosporidium parvum Iowa II] >gi|46229720|gb|EAK90538.1| hypothetical protein with signal peptide and 8 or more transmembrane domains [Cryptosporidium parvum Iowa II]
Score 78
Evalue 2.70484
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whem1k13
AAATAGTTTCAGATATCTTAGGTTCAGTGTTATTGCTGGCTCTGGATTCAGGCTCAGGTTCATGTTGATGTGTGTTGTAACAAATTAGGTGCCAACCTGG
AACATGAGAAAATTTACATCTCTAGAAAAGGACCAGTTAGATGTGTGCCTTAATCCTGTTTGGTTCATATGCATTGCTTCTGCTTTTTATTTGTACTATC
AAA
page-top