Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20p10
Contig Information
Length 280 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20p10   
Homology (BLAST) Top Hit hypothetical protein OsI_38957 [Oryza sativa Indica Group]
Score 254
Evalue 1.04274e-20
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20p10
GATGTGGNGGNACAGCCGACCGTCCACGTAGGCGACGACGCCTGAAGCCGCGAACCTGCCAACCGTCCACAGCCTGCTTCGCTTAACCAGGGCTCCTCCG
CCGGACGACGATTCACCTTCGTCTTCGCCTCCAGTGAGTTGTCCCTTCACTTTGGTCGTGACCTCCGCTATGGCCTTGGTGGCCTCACGGNGCAACAGGC
GCACCGCGAAGCTCACAAACAGGTGCTCGCACAGGGTGAGCACCGTCNGCGCAATCTTCCACTCANGCTCATTTCNCAGA
page-top