Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1j09
Contig Information
Length 434 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1j09   
Homology (BLAST) Top Hit hypothetical protein OsI_23887 [Oryza sativa Indica Group]
Score 229
Evalue 8.32817e-18
Total Hit Count 114
Registered year 2003
Contig Sequence     [ Download ]
>whem1j09
CACCCGCGGCTGCGAGTCCATCACCCACTGGTCGCGAGGACGACCCTTCCTAGGTTGTAAACAGAATCCAGAAATTACGGAAGACTACTCAGCTTGAACC
TACAGACTTAATTGATGTTTACTACGAGTCTGTAGACAACAGCAGCAATACACTTGAAGAAATTTTGCAGTCACAGGATCAGTGTATTAGGGACGTGCTT
GGTAATTCACTAGTTCCAAAGGCAGCGGCAACATCAGATATGGAGTAGGAGGCACTACTGAACTTTGCAGCGATGCTGAAGCAACGGATGACACCAGAAA
CAAACTGTCACTAGTTTCCAGTTTGATGCTGAATTATGAATGAATGCCTAGACAAAGTTGGATTTCGTGTTGCTGACCGACTGCTGCTTGGGCCCTTCGC
GTGGCGTCGTCTCTTCCTTTCACGAAGTTTGTTC
page-top