Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1i23
Contig Information
Length 422 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1i23   
Homology (BLAST) Top Hit hypothetical protein OsI_00686 [Oryza sativa Indica Group]
Score 586
Evalue 3.3988e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whem1i23
ATGGTGTATCTATCCAAGCTATGACTATGCTCATTGCATGGTGGATTCACTTGAAAACATTACACATTCTTTGTGCACTCTTGAGTTCGACATACGCCGC
CCGTCATACTACTGGCTACTTGTTGCCTTAGGCTTGTACCAGCCACATGTTTGGGAGTATTCGAGGCTAAACATATCACATACTATGATGTCCAAAAGAA
AGTTGAACCGGCTTGTGACAGAGAAGTGGGTAGATGGGTGGGATGATCCTCGCTTGTTGACTTTGGCAGGACTGAGGCGACGGGGAGTATCANCAAATGC
GATCAATTCATTTATCCGTGGAATTGGGATAACGANAAGTGACAATANCTTAATTCNNGTTGACCGNCTTGAATATCATATCANANAANAACTGNATAAN
ACANCTTCTCNAACCATGGNTG
page-top