Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20p13
Contig Information
Length 771 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20p13   
Homology (BLAST) Top Hit hypothetical protein OsI_24420 [Oryza sativa Indica Group]
Score 451
Evalue 1.04121e-45
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20p13
GCACCTGATACATGCCTCGACCACTTCAGTGAATAGGTTACAGTGCCACAAATAGGCACTGTTGTGGGGATTACAAGTGGTCAAGCATTTATTTTATTAC
TAGGATACATCGCTCATAATTTAGGAAACTATACAACAGCATATTAGCTCCCTCGACTGATCAAAAAGCATACCAGCATTTCTGCTGATTTTGCATTCAT
AGGCACATCCCCGGAGGTCGAGATCAAGTAAAGCGTATAGTATAGAGCTTCCTGCAGCTTATTTCCCTTGCCAACCAAAAACTTGCTCTCGTGTAGCGAG
CACGAGGAGTGAAGGTCTGAAGGATCAAATCCCCGGGAGAATATCAGCAGAACCGCAAAGCGTGCTCAAGTTCCTTCTCGTCGGCACAGCTGTAACCCAA
CTGATAAGCTCGTGCAAATCGTCCAGATCCCATGAATGGCTCTGCTTCATCAGTCACGCCACCTTGCTGCTGATCAGCATCACAAGTGTCCCACTCATCA
TCAGGACATAAAAATCTCTCAAAACAGTGCCCAGATATCGTACAGACAAGTAACCCGCTAGCTTGGTCCAAGACAAATTCACGACAGGCATCATCGCAGA
CTGAAAACAGCAGAAAACAACGTTGTCAGGCATGAACAATTATATGTGACGAGTGAGGAAATATAAATATACCATGTACACGACCAGTCTTCTCACAGAT
ATAAGCATCACCAAATCTGCTTATAGTAGCAAGTACTTCCGGAGCANGAATGNCCCCTTGACTGCATCATC
page-top