Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6l16
Contig Information
Length 282 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6l16   
Homology (BLAST) Top Hit OSJNBb0015D13.3 [Oryza sativa (japonica cultivar-group)]
Score 205
Evalue 2.79684e-16
Total Hit Count 250
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6l16
GGAAGGATTCCCAAGGCCCTTCCATACTCGACGACGCTGCNATATATTCCGTNCAGGTATCTTGTACTTGTACTCAAACCCTTCCTTGACGAGCTTCGCC
GACGAAATGCAGACTCTCGGCTTCTCAGGGAGATCTCTGAACCTATCTGNATTGACCTTGTACTGCGGGTAGTTGGCAGCCAAGAAGCGGGCAATCTCGA
CGGCGGTGGGGTTGAGGCCGCATACGATGTACCGCCCCGACGCGGNCTCCTCCTCGGCCACNAACATCTCCGCTCGGCANAG
page-top