Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6k22
Contig Information
Length 750 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6k22   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 676
Evalue 3.60571e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6k22
GTTCAAGCTCGACACAAAACTAGCTTCTCTCGTACAAGTTATGTTATGTGTGGCATTACGCCGCCGGAAATTTTATTTCAAAACTCAAATCTTCCATGCC
CACATGATGGGCAGAAAAAGCACTGGACAAAACCAACAGACCCCTCAACAAGACCTGGGTTTGCTATAATCTGCAAAATGGCCTAACTAACTTGCATTCG
CGAACGCGACACCCTTCTCAATTGAAGATTTGAGCTCACCCTTGAGAGCTTCCAACCCTTCCTTCTCAAACTGCGTCAGCTGACCCAACCCGAGCACTTC
CTCGACTCCATTCTTCCCAAGCCTCACCTTGGAAGCAAAGAATGGCAGCTCGGTCACAGTTGATTGCACGTAGGAGCATTCAACAATGTCAGGAACTCCG
TTCAGACCCTTCAAGCATGCATCTCCAAAAACTGCACCAGCATACGCCATGGACAAGGTTGCAGATCCCTTTCCAGCCTTTGCCTCAACGACTTCTGTGC
CACCCTCCTGTGTCCTCTTGGTGAGAGCCTTGATTTCTTCAGCAGACAATGCATTAGTTGAAGGAGTTGCCTGTGAGAACAGTGGCAAGATGGTAATACC
AGCATGACCACCAACAACAGGAACGTCCACAGTATTAACATCTACATTAGCCTTCCCAGCATAGAAAGTCCTGGCACGAACANCATCAAGAGTGGTCACA
CCAAACAATCTCTTCTCATCATAGGNTTCCAGCCTTCTTGAAAACTTCAG
page-top