Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6k23
Contig Information
Length 518 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6k23   
Homology (BLAST) Top Hit ELF3 protein [Triticum aestivum]
Score 144
Evalue 7.24811e-08
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6k23
GGGCAAAAAAAGAAACATACCAAATTTCTTTTATAAGATATCAGCAGGCACTATAGCTGCACATACATAGATAATATAGCAGAGCCATCACTCCCAGGTT
TCACTTCTTTTTGCCTGAGACATACATACACCTAACACTAACAGTTACAGTTTTCATTCTGGCATAAATAGATAGATAGATTGATAGATACAAGTCCTGC
TTTGCCCAACCAGCACTCATTCTGTTCTGGCAAGTCCTGCTTTGCTTTGCATATTTACAGTCGCCAAAAATTCGCTTTTACCGACACCGAGGGACAAATA
TATAGGAATCTATTTGCTTGCTGCCTGCCTGCTCAAAAATAACAACATACTCCCAAGCGCTAATTGGCTAAGCTTTCTTCCTTCCTTTCTTTCTTTGTGC
CGGCCAACCACTGCATGCGGTCGCTCGGTCACGGGCCGTTCTGCTGCCTCTCCATCTGGATCGACCGGAAGATGCGCGCCGCCGACTCTGACGCGGTGCG
CGCTGTGTGCGGGACCAC
page-top