Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1i06
Contig Information
Length 311 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1i06   
Homology (BLAST) Top Hit microtubule associated monoxygenase, calponin and LIM domain containing 3 isoform 1 [Homo sapiens]
Score 84
Evalue 0.538167
Total Hit Count 27
Registered year 2003
Contig Sequence     [ Download ]
>whem1i06
AGCGGCGACCACCCTCCTCCACCGAATGTCTTCCCTCACCACCACCCATCTCGCGAGCGTCCTCCCCGACCAGGCCTCCTCCCCACAAGCTTCACCAGAG
AACCTAGCGGGGACCCCTCCTCTACGTGCTCTACCCCAGGCAGCGGAGCGTCGACCCTCCTCGCGAGCAGCTCTGCCTTTCCCTGGACAGCGCTGCCTTC
TCTACTTCCTTGCTCCAACCACGAGAATTTGACAGGTTTCCCAAAGATACACTACTTGATGGAGATTTGGATGATCTACAAGCTGCTGAAGGTTTGCAAG
ATCTACTATTA
page-top