Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20p19
Contig Information
Length 734 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20p19   
Homology (BLAST) Top Hit hypothetical protein OsJ_004596 [Oryza sativa (japonica cultivar-group)]
Score 108
Evalue 2.78708e-10
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20p19
CGGTCACATATAACCTGGCACGGTAGATTGCGCTTGCGCTTCAAATTCAATAGGTTAACATGTCAAGAAACTAAGAATGCCTTCGTAGATAACATAACTG
TGTCCAATACATGCCATGTCAGTGTGTTACTCCACGTGAATCACTTGTTGGTAGACCAGATCTTTGACCTGGAGAGTGCACCAAGGGAGTACCTTTGATT
GGCTCTTCTTTAATACATACATCTGCAGCGTCCAAATCGTTCAGCACGTCCTCGGCGTCATAGGTGACAGACTTGAATTTGGTGGGCTACCGCCCAACAA
CTTCCCCGTCTGTTCCTCCTCGATGCAGCTATGATACACATCGTGCAAACGGCTTCTAGATCTTGCATCTTGTCCACCATGGCATCAACATTGTCTTTAG
ACCTCCACAGCCAGGCGGCCTCCTCCACGGAGGGTTCACCAAGCTTGTTCGCGATTTGTTTCCCCTAGCATATGCCTTGATGCATCCTGGTTGGAGATCC
TTTTCCTGAGTGATCAAACAATGACGTATGGCCTGTAGGCTGCGGCAGCTAGAGCATGGACCTTCAAGCGTACCGATGCTTTCTTAATCATTGTAAAAAC
ACCAGAAGATTCAACAATATATCCAGTTCATACCAGGATTTCCTTTTGTACTTGAGCACACATGATCTTTGTGTAGATAAATAGAACTAAATAAAGCCAT
CATTTAGCTGNCTTTTTCTCCTGGATATCTCGTA
page-top