Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1h09
Contig Information
Length 392 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1h09   
Homology (BLAST) Top Hit ATP-dependent transporter YFL028C [Zea mays]
Score 309
Evalue 4.37234e-27
Total Hit Count 175
Registered year 2003
Contig Sequence     [ Download ]
>whem1h09
AACTCCCCTGAAGCCTGAACGGAGCGGCGGAGAGGAAGGGGAGAGATCACCCGCCGGCGGCGAGGGGAGATGGCCGGAGGCGAGGAAGGGTGGAGGAGGA
GCGGCATCGAGTTTGTGTGCAGTGGTGACCTTTCCTACTTGGGTGGTTCGTGGAGTCGGAATGTCAGTTCAGTTGGTGATGTTCCACTACAAGGCGATTT
CTCTGCTGAGCACATGATATTTGGAGTTGATGGGGTTGATCCTGTTAGGCGANAGCAGCTGATTGATCTACTGGATATTGATCTGCAATGGCGCATGCAT
AAAGTTTCACATGGACACCGCCGCAGGGTACAAATTTGCATGNGTCTTCTTCATCCATACAACGTACTCTTACTCNATCAGATCACCGTGGA
page-top