Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem6l02
Contig Information
Length 779 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem6l02   
Homology (BLAST) Top Hit protein phosphatase 2A B'kappa subunit [Oryza sativa (japonica cultivar-group)] >gi|49328037|gb|AAT58738.1| protein phosphatase 2A B'kappa subunit [Oryza sativa (japonica cultivar-group)] >gi|125595158|gb|EAZ35217.1| hypothetical protein OsJ_018700 [Oryza sativa (japonica cultivar-group)]
Score 778
Evalue 5.77214e-81
Total Hit Count 448
Registered year 2003
Contig Sequence     [ Download ]
>rwhem6l02
ATGAGTCTCAGCACAAGGGCGCTCGCTCACAGGTACATTTGCCTCTAGAGCATACACATAGTGGGCATAGTTACAACGTACAGAAGAAAAGCAAAACGAC
GAGCCCTGGAGTCGATCATCACTTGGGCGCGCTTCACCGAACAGGGGAAGAACACCATTGGTATGCACCTCCACCGACCAAACACACGCTAAACGATGGT
GGCGGCGACAAGATTATCGCCGACGGTTGGTGACCTACCCCACCAGGACGGCGGTGTGGCCAGTCACTGGCTGGAGAGCTGCGGCGGACTCTAGTTTCGC
CCACTTCAGCCTCCGCTTCTCCTCCATCGACGCCTGCTTTTCCTCGTCCTCCTTGCACTTTGTTAGGCACGCCGAGAATAGTTCCTCGTCCATCTCGGAG
AACATCTTCATTACGTTGGCGGTCAGGTTCAGGACCGCGTGGTTCCAGTGGTTCTGGCCATTCTGTTCTAGCGCCGGAACGATGATGGGCATGATCACTT
GCCGGTTTTGTGCCACCAGGCTGATGATGTGATCATTGTTCCACATGAAGAGTGCTCTTTCAGCAACCTGGAAATGAGAACTGTTGATGCACTGAGCTAT
CCGCCGAAACAATGGAACCATACATTTCTGGAACTCCACCATGCTGGTAGCCTCCAGGATCTCCTCAATCTCACTCAGGAACATCACCTCCTTCTGACTA
TTTGTCACCGGCCAATATCTCANCANACCAATGATTATCGATCCGGCAAGCTTGGGGTCCTTTTCTAAAAACTGTGTCA
page-top