Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem14k05
Contig Information
Length 616 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem14k05   
Homology (BLAST) Top Hit hypothetical protein OsI_32297 [Oryza sativa Indica Group]
Score 548
Evalue 1.63858e-54
Total Hit Count 28
Registered year 2003
Contig Sequence     [ Download ]
>whem14k05
CGACAGGCACGATCTATTCAAGAGGTTGCTAAGAAGGACTTTGAGAATCTTCGGCAAGATAGTGATGCCAGTGAACCAGAACCAGAACCATTACCAGAAC
CGGAACCAAAACCACAGCGTCGAAGGGGCAGGCCTCCAAAGAACGCTGTCAAGCAGCAAGTTGAGCAGCCACCAGCAGAACGTGCTACCGCAAACTTTTC
TGCGGCGGCACTTGCTATGGCTGGAAATAGTGGACTTTATGCGCACTCAGGGTTTGATATACAGCGGAGAATTGCAGATGTACTGAAAGCTTCTTTTGCC
AATAGAAGCAATGAACACAATTGGTCCAGTGAGCGCAAATTGGAAAGCATTGAAGATTATTCAGGGTCTGGGAGTAAATGGTCAGGAAAAATGGGGAAGA
AGCCACTTCTGGTAGAAGAGAGTCGCCGAACTACATATTATCAGAATCAACCATCCAGTTCAATGTATGAGCTGCCAGTGGCAACCTCATACAATGGGAC
AAGGAAGGTTCTTGTACCAATTGGTGCTCANTTGCCACAGGCCTATTCCCGCAGTCTGGCACGTTTTGCTGCACAGCTTGGTCCTGTTGCTTGGGAANTT
GCNTCNANCNANTTGA
page-top