Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem14k04
Contig Information
Length 528 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem14k04   
Homology (BLAST) Top Hit Os07g0647100 [Oryza sativa (japonica cultivar-group)] >gi|33146499|dbj|BAC79608.1| unknown protein [Oryza sativa Japonica Group] >gi|50510248|dbj|BAD31454.1| unknown protein [Oryza sativa Japonica Group] >gi|113612002|dbj|BAF22380.1| Os07g0647100 [Oryza sativa (japonica cultivar-group)] >gi|215694425|dbj|BAG89442.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218200129|gb|EEC82556.1| hypothetical protein OsI_27100 [Oryza sativa Indica Group]
Score 604
Evalue 3.00638e-66
Total Hit Count 166
Registered year 2003
Contig Sequence     [ Download ]
>whem14k04
TCCCAACCGCTCCCCACGCCGCCGGGTTCAGTCCCCTCAGCCGGCGGCGAGATGTCCTTCTTCTTCCGCGCGGCGTCGCGGCCGCGTTCGTCGCAGCAGG
ACCTCGTGCGCTCCATCAAGGACTCCCTCCTCGCGCTCGACACCAAGACCGGCGCCAAGGCCCTCGAAGATGTTGAGAAAAACATATTCACCTTGAGACA
AACACTTTCTGGTGATGGAGAAGTTGAACCAAACCAGGATCATGTCTTACAGATAGCCCTTGAAATTTGCAAGGAGGGTGTCCTTTCTCTTTTTGTTCAG
AACCTGCCTTCGCTGGGTTGGGAGGGAAGAAAGGATCTTGCTCACTGCTGGTGCATTTTGTTGAGGCAGAAGGTTGATGAAAGTCACTGCTGCGTGCAGT
ATATCGAAAATCATGTTGATCTTCTANATTTCCTTGTTGTATGCTACAAANAACTTGGAANTCNCATTGAACTGTGGAAACATGTTNCNAGAATGNNTAN
AATATCCCTCACTTGCAAAATATATATT
page-top