Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem14k01
Contig Information
Length 600 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem14k01   
Homology (BLAST) Top Hit hypothetical protein OsI_00099 [Oryza sativa Indica Group]
Score 571
Evalue 3.31072e-57
Total Hit Count 185
Registered year 2003
Contig Sequence     [ Download ]
>whem14k01
ATCTGCTACTGCTCAGGGTCCTTCCTCAAGTGCCACACCTGCTACAACGGCACCTTCTGCTAGCTTATTAGGCCCAGAAACATCAAAGCCTCTGCTGCCG
AACATGGTACCTTTGTTTACTCCTCCGGTGCCATCTCATGGTGCCTCTCTTCCTGTAGCCAGTCAGCCAATTTCCATGACTGAAACTAGTGCAACAGCAT
CACAGAGCTTAAATTCTCTTGTTAGTAGTAAGACTCCTGCTGTAAATCCAGGCTCAACACTGTCGCACCAAACAGCATCCCAGGCAATTTCTTCGTCTGT
TGCCTCATCTAGTCTTGCTGGATTGGAGATCCCAGCACCTTTGTTAGCATCATCTGGCCAGCTATTGCAGAATGCTCCATCCATGCTTTCATCATCTCAG
TCCATGCAAACACCTTTACAGATGAGCAACAACATCGCCAAGCCTGCTGACACTAAAACAAAGGTTGCAGAACCACTGCTACCTGATCCTCCGGCACGTG
CTGAAAATAATGAGCCTATACTGCCATTGCCAAAACAGACACCTCAACGGCACAATGGAGCTGGTTCACAGGGCCACCACAACTATAGGGGCCGTGGAAG
page-top