Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhem20p22
Contig Information
Length 760 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem20p22   
Homology (BLAST) Top Hit RecName: Full=T-complex protein 1 subunit epsilon; Short=TCP-1-epsilon; AltName: Full=CCT-epsilon; AltName: Full=TCP-K19 >gi|435173|emb|CAA53396.1| T complex polypeptide 1 [Avena sativa]
Score 838
Evalue 6.06626e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhem20p22
AAACTGGTATCGACAGGATATGTGCTACTGTCTCTCAAGCTCTACAAAGTGTGAACTCACGTCACAGAACTAGATAGCTCATCAAATAAAACAAGTGACC
ACTCCATGTAAGAATTCTAGGAGCAAATCCAAATCAACCCATATAAAATATGCTGACTAATGGAGTGCATGCCACTTAGCACAGTCGATTCCGTTCTTGA
AGGCGTCATCAATACTCAGAAGGCGTTATGACATCATCAATCTTGAGGATCATCTTGACCACCTGTGTTGCCAGCAAGATCTGCTGCTGCTTGCCTATCA
GAGTCTCGAAAACATTCTGCTCTTTCATGTCATTGGTACCAACATCATTGCAATCGATGCCACAGCGAGAATTGTTCTCCTTGACATGTTGGGATTTTAC
GACGGTGAGAGTATCAATAGGCGGCAAACCACTGTTTTCAGCTAAAGCTAGTGGAATGGCATCCAAAGCATCAGCAAATGCCCTGATTGCATACTGCTCG
ACTCCAGGATGACGATCTGCTGCAGCATCAACAGCAATTGAGCAAGATATTTCTGCTGAGCCACCACCATATACAATTGAGTTGTTGATGATCAGATTCC
TTGCAACACATAGAGCATCATGAATACTTCGCTTGGTCTCTTCAATCATCATTTTGTTGCCACCGCGGATGAAAATAGTTACAGCTTTGGAATTGGCACA
CTTCTCGATGTAAAGCATCCGATCTTTTGNTGTTCCAAATGACTTCTCTCTGACTAACCC
page-top