Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1f10
Contig Information
Length 289 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1f10   
Homology (BLAST) Top Hit lipoprotein precursor [Lactobacillus plantarum WCFS1] >gi|28270634|emb|CAD63540.1| lipoprotein precursor [Lactobacillus plantarum WCFS1]
Score 92
Evalue 0.0652063
Total Hit Count 26
Registered year 2003
Contig Sequence     [ Download ]
>whem1f10
ACGAGAGAAGAAACTGTCAATCCTGCTGATGAGCAAACGGGAGACAAAAACTCTCCTGCTGCAGATGATGATTACAGCGAGCAGCTTGCTGAATACGGCC
ACAATAGTGATCGCTACGATGGCAGTAACTGTGGCGACTACTGTGACACAGATGGCGACTGGTCTGAGATCGGTGGATATGATGACTACTACAGAAAGGA
TATTCCACCGAGTCTCAAAATTGGCTATCACGGAGACAGCATTAATCTATCGATGGCTTACAGCCTATCTCGGGACTTGGTGGAGCTGT
page-top