Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1e23
Contig Information
Length 276 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1e23   
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 176
Evalue 1.16378e-11
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whem1e23
CCCTGGGGGGCGGTGGCCGTATCGGCGGCGGCGGCCTTGGATTCTCGTCCTCAGCCGGTGGTGGCCATGGTTCCTCCATCCCACCCTTATCTTCTCAAGG
AAACTCACATCAGTATTCTTCATATGGTGGTGGATACCAGAGTGGTAGTACAACAAAAAAGATTGACATCCCAAATGGAAGGGTTGGTGTTATCATTGGA
AAAGCTGGAGAAACTATAAAGCATCTCCAAGCTCACTCAGGGGCGAAGATCCAAGNAACAAGGGACATGGATGTTC
page-top