Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1e11
Contig Information
Length 154 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1e11   
Homology (BLAST) Top Hit homeobox-like resistance [Triticum aestivum] >gi|167882868|gb|ACA06113.1| homeobox-like resistance protein [Triticum aestivum] (no hit)
Score 505
Evalue 1.1803e-49
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whem1e11
GCAGTGTGACGCACTAGCTAGTAACTAAATCACCTGCTGAGCGGGCTCTCCTTCATTGCCCAAGATGAGAGGAGTTGTGGTGGTGGCCATGCTGGCCGCG
GCCTTCGCCGTGTCTGCGCACGCCGAGCAGTGCGGTTCGCAGGCCGGCGGGGCG
page-top