Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1a07
Contig Information
Length 298 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1a07   
Homology (BLAST) Top Hit guanylyl cyclase [Triticum aestivum]
Score 473
Evalue 6.94261e-47
Total Hit Count 92
Registered year 2003
Contig Sequence     [ Download ]
>whem1a07
GCCGATCCTACTTCATCGATGTCCCTCACGNTGCAGCAGGCCTTCACCTGGGACTGCGGCCTCGCTTGCGTGCTCATGGTGCTCAGGACCCTGGGACTTG
ATTGCTGCCACGGCATTGCCGAACTCGAGAAGCTCTGCCGCACCACAAGCGTCTGGACAGTCGACTTAGCATATCTGTTACACAAGTTTTCAGTTAATTT
TTCGTTCTTTACTGTGACTATTGGAGCAAATCCGCAGTATTCTGCAGAAACCTTTTATAGGGAGCAATTGCAAGAAGACATTGACCGAGTGGATGAGC
page-top