Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1c04
Contig Information
Length 113 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1c04   
Homology (BLAST) Top Hit hypothetical protein OsI_10600 [Oryza sativa Indica Group]
Score 149
Evalue 1.60381e-08
Total Hit Count 28
Registered year 2003
Contig Sequence     [ Download ]
>whem1c04
CTCCCGCCCCTGCGCCTGTTTCGGCTGTTGATGCTTATCAGAAGATGCTTTCATCTATCGCTGAGTTCTCTGGGTTTGGAAGGCTCTTCAAGTCCTCNGA
ATCCTGTGGAGCT
page-top