Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1d12
Contig Information
Length 579 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1d12   
Homology (BLAST) Top Hit hypothetical protein OsI_24437 [Oryza sativa Indica Group]
Score 264
Evalue 1.20855e-21
Total Hit Count 67
Registered year 2003
Contig Sequence     [ Download ]
>whem1d12
TCCAAGCTGAAAGCACGAATGTTGTTGATGGATCTGTTTCCTTCAGCACTTCGCAGAGTCATTCATCCTCCAATATAGAGGATACACCACGTAGTGAGAG
CTTTGTATTAGAGGCACCTGAGGTGGTAGGACCGTCAAATAAAGAGGAAGGTAGTCATGATTCTACATTACAGAACACAAATTCTGATGCTAATGTTAGT
GAAGTTGCGTCTTCAGAATCTGAACAAGCTTTGACCTCCAAAGAAACAGAGGAAGATGGGAAAAGGGATATGTTAGTAGAGCACCTTGATATACCTGTTC
AATCTTCAGAATCTACTGTTGCCTGCCCTTCTCATGAATCTTCTGTTCTCGATGGCGAAGCTTCTGCTCCTGCTCCTGACCTCGCTGAAGCTAGTAAAGA
AACCTGCAGAGAATATTCTACCATGCAAATTCATGACACTCAGGCTTCTGATGCTGCCCCTCNGGTTTCTGATACTGAGAACAGCTGTGACTCGGCAACT
GTAACTGGNCNAGCTACTCCTATGGGNGCTACACCTCAGGCTTCTGATACTGCCCCCCCNCGNTTCTGATACTGCNAAC
page-top