Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1d04
Contig Information
Length 318 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1d04   
Homology (BLAST) Top Hit Os03g0271800 [Oryza sativa (japonica cultivar-group)] >gi|113548166|dbj|BAF11609.1| Os03g0271800 [Oryza sativa (japonica cultivar-group)]
Score 83
Evalue 0.720211
Total Hit Count 31
Registered year 2003
Contig Sequence     [ Download ]
>whem1d04
CGATCTCTCCGAAGAAATCGCCACAGCCGTACCTCCTAGCTTTGCAGCCAGGGAACCCGCCATCAAGAGGATGGCGTGGACGGAGAGCACCACTCCCCGT
GTCACGTCGCCCGCCGCTAATCTCCTTGTCTCCGTCCGCTGAGGAGCCGACGGACGGCTTGGCGGCAGTCCCACGGCGGCTGGGCTCCCCATCACTCGAC
GAGGTTGAGAGAGAGCGGCGGCTCCCCAACAATCTCCCAGCAGCACCAGCCGCCTGCCGGTCCTGGAACTCGACGTCTCGACCTGCAACCGGCTGTCGGC
CAGTCCCAATGATGTGGG
page-top