Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1b13
Contig Information
Length 193 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1b13   
Homology (BLAST) Top Hit F1-ATPase [Triticum aestivum]
Score 196
Evalue 5.68741e-14
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>whem1b13
GTCTCTTCCTCCTCTCCCCGACCCGATCTCCTCCTAGGTTTCGCTCTCCACCACCGCGGAACGAACCGGAAATGGCGGCGCGGCACCTCAGATCCGGCCT
CCCGCTCCTCCAAGCTCGCCTCGCGGNCAACGAATCCGCGGCCGTCGCTCAGGTATCGAGGGGGCTGGCAANGGAGGCGGATAANCCTAAGGA
page-top