Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1a20
Contig Information
Length 249 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1a20   
Homology (BLAST) Top Hit hypothetical protein OsI_09535 [Oryza sativa Indica Group]
Score 317
Evalue 5.15068e-28
Total Hit Count 26
Registered year 2003
Contig Sequence     [ Download ]
>whem1a20
TCGCTCCGTGATAGCTTGGTGCTTCCAAACTGTGAAAGCATTTCCATTCCAGGGATGTTGGCAGAAAAGGATGACTGGGTCCCCCGCAAGGATGGACCTT
ATATCTGGCTCAACCATGAACCCACCGAGGCCAAAAGCCATGTCGCAGCCGCCACACCAACCCATCCTGAGGAAGCTGGCCCCAAGGACGATGCCATCAG
CAAAAGCAGAGCACCAAGTCTGCCTGCTTCCTCANCCGGGAGCGAGGAG
page-top