Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whem1a19
Contig Information
Length 122 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem1a19   
Homology (BLAST) Top Hit hypothetical protein OsI_26455 [Oryza sativa Indica Group] (no hit)
Score 308
Evalue 5.83937e-27
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whem1a19
TCGCTTCTCACAACCCGCAACACTACCTCAACATGAAGACCTCTCTCGTCCTCCTCGCCGCCGCGGCCTCCGTCTCCGCTCACTCCACATGGCAGCAGCC
TGTGGGTTGGCTCGACCGACCA
page-top