Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1844
Contig Information
Length 1236 bp
Tissue Callus
Clones 5 Clones [Download: CSV  ,  FASTA ]
whcs10f18    whcs11e05    rwhcs10f18    rwhcs11e05    rwhcs11e06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0533700 [Oryza sativa (japonica cultivar-group)] >gi|42761395|dbj|BAD11663.1| cation exchanger-like protein [Oryza sativa Japonica Group] >gi|45735791|dbj|BAD13154.1| cation exchanger-like protein [Oryza sativa Japonica Group] >gi|113624316|dbj|BAF24261.1| Os08g0533700 [Oryza sativa (japonica cultivar-group)] >gi|125604138|gb|EAZ43463.1| hypothetical protein OsJ_026946 [Oryza sativa (japonica cultivar-group)] >gi|215707134|dbj|BAG93594.1| unnamed protein product [Oryza sativa Japonica Group]
Score 988
Evalue 5.44028e-105
Total Hit Count 471
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1844
AATCTTTCTTCAGCAAACTGCATAACCATGTTGAGTTGAGCAACAATGCTCCTCTGGAACACGGGTTCAAGTTTATCTTCATACAAGGACCGTTTACAAG
ACTTCACTACTATCTTAGCGGCCACTGGTGACACGCCATGGCGACCGACATCAGGTGATCCGTACGAGCAGAACCACCATGACAAACATGCAGGTCATTA
AAAAGATGAGCAACCACTGGAAGCAGCTCGTCTTGGAGGCCAGCGAGTAGACCTCCGAGGCTCGCGCCGTTGCACGGCCAGTACTCGCCAGGCTATGTTC
CACGGCTCTCTCCGTGGAATCGAGGATCTTCTCTGTATCTTGCACGGATTGGTTCATTAAAAGGCTACTCTCCTTCAGCTGGCGTGCTAAGTCAACCATT
TCGTCAGTCAGATCTTCTTGCAGCTTCCTATGCTTCTCAATATGAGCCTGAGCTTCTGCATCCAATTTAATAGGTGCTCCAGTGTCTCTTTCTTTTCTTT
CATGACTGCTTGGTCCAACCTCCATCTGAGCCGTCGATCTCCTCCGCAGTCCTGATGATAAGGATATTGGACTCCCGACCTTTTCTCTTTCATAAGAGCT
GTCTTGTTCTCTACTCTCATCAACCAGATTTTCATTTTCTGGCACTAGAGAAGCAAGCGTGGCAGCTAGTGCTTCAATCTTTTCTGAATACTCACTGAGC
TTAGCTTTTGAAACACTTGATATTCCTTCTGGTGTAATTTCAGCTCCAAGTTGCTCCAACAGCTCCCTGGCTGTGGTTATGTAATGGACAAGCTTAGCCT
GATTCTGCTGGCGGGGGGCCGCCTCAAGCAGCCTTCTCAAGTTAACTTCCACCTTGCTGAACACCATGACTAACTAATACCTTGTTGAGGTGCTGAACCG
TGGTGAGAAGTGAGCTGCCGAAGCCGGATTGAAGGAGCAGCTGGGAAGCAGAGCAGCCGGACTGGGACTTGACTCACGGGTAGAAGGGCTTGGCCGCAGG
GGATCTGGGCGTCGAGCTTGAGGGTTACAGGGCCACAGGGGTGTGGAGCTTGAGGGTCGCCGTCCGACTGAGAGCCCACGAGGGAAGCGTGTCGAGCTCG
AGCAGGAAGTGGCTGCCCTGCTGCCTCAACGAACGGGAAGTGAGCGGGGGCTACGCCATCCGGTGATCTCTCCTCTGCCTCTTCGTCCGGCCTCCGGCGC
CAGCCGCCAGCCGCCGGCCGCCAACCGAAGAGAAGG
page-top