Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1813
Contig Information
Length 742 bp
Tissue Callus
Clones 5 Clones [Download: CSV  ,  FASTA ]
whcs10f07    whcs10l23    whcs11k05    rwhcs10f07    rwhcs10l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L21 [Zea mays]
Score 835
Evalue 1.30168e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1813
ACACCAACCACCCTTCTCCCGCCGCCGCCCCGCGAAGCAAAGCAGGAGGAGCAGGATGCCGGCGGGCCACGGTCTGCGGTCGCGGACGCGCGACCTGTTC
GCGCGCCCGTTCCGGAAGAAGGGTTACATCCCGCTCACCACCTACCTGCGCACCTACAAGGTCGGCGAGTACGTCGATGTCAAGGTGAACGGCGCCGTGC
ACAAGGGTATGCCGCACAAGTTCTACCACGGCCGCACCGGACGCGTGTGGAACGTCACCAAGCGCGCCATCGGCGTCGAGATCAACAAGCAGGTTGGAAA
CCGCATTATCAGGAAAAGGATCCATGTCCGTGTTGAGCATGTGCAGCCATCCAGGTGTGCGGAGGAGTTCCGCCTGAGGAAAGTGAAGAATGACCAGCTC
AAGGAGGAAGCCAAGGCACGTGGTGAGGTCATCAGCACCAAGAGGCAGCCGCTCGGCCCTAAACCTGGGTTCATGGTTGAGGGTACCACAATCGAGACCG
TCACTCCCATTCCGTACGATGTGGTCAATGATCTCAAGGGTGGTTACTAGGGTGTTTGGGTTATCTGCCTGCACAACCAGTTCAAATCTATGGTGCTCTT
ATGGGTTGGATTTGCTCTCTGAGCAGTAGTCTGGGTTGGGTCTTTATTCATGTCAAGAAGATTTTCGGTGTAGGTTGCTATCATGAGTTTTGCAGAAATG
CTATACTGTGCTATTTCCTTAAGAATGATGATGTGCTCTTTG
page-top