Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1811
Contig Information
Length 670 bp
Tissue Callus
Clones 5 Clones [Download: CSV  ,  FASTA ]
whcs14b01    whcs1g22    rwhcs9m05    rwhcs14b01    rwhcs1g22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DNA-directed RNA polymerases I, II, and III 14.4 kDa polypeptide [Zea mays]
Score 495
Evalue 2.76134e-48
Total Hit Count 230
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1811
TAACGCAACCACGCAATTGGTTTACAGTAGTAGCACAACACAATGGGCAGACATAGCCCACACATGTTACGATAGCATAACATTGTCACAGCAGTTCAGT
GCTAAACATTGCATATAGCTACTAGGGCAAGGTTTTGTTGCAGCACAGAGTCTTCCATTCAAACAGTCTACCAGCTTTAGTCCCCGCCAACCTGACGCTT
CCACGAGTCCTCCACAATGAGCTCGTCAACTCCCCAGTCCTCGTAGCTTCCATCAGGTAAGTACCGCCTAATCGTGAAGGGGATCTTGCGTGCTCTCAGT
TCTTTCATGGCAATCTCAAGAGGATCAGTTTCGCCCTCAAGCTCAACCATAACTGGGGCATTCATGCTTATCTGCAAAGCACGTGTGCCAAGGATGCGTG
CCCGCTCATACTTGGTCATATATTTTGTTGTATTGCGTGGACGGGCAGTCTTTTCCTGTTCCTTTTCTTCACCTTCACCCCCTACCACGTCATCAGGGGC
ATCCTCGTTGTTCTCAGGATCTTCTTCAACCCCTTCCTCAATATCAGCCTCTGGAGGCTCATCCTCGTACCCCATGTCAACTTCATTGTAGTCGTCGTCC
GCCATGGCTGCCGCCGCCGAGCGCTCCGGTCGCTAGGGTTTCGCCGCGGGAGGAAGCCTCGGGCGTGGGG
page-top