Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1786
Contig Information
Length 757 bp
Tissue Callus
Clones 4 Clones [Download: CSV  ,  FASTA ]
whcs10e18    whcs13d17    rwhcs10e18    rwhcs13d17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.1
Score 459
Evalue 5.28743e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1786
CTCAGCTCCCACCCACTCCCAAACCCTCTCGCCGGAGCCCCAGCAACCCGCCAGCAAGCAAGATGGACGGCAGCAAGGCGAAGAAGGTGGCGGCGAAGAA
GTTCGGCGGGCCGAGGAAGAAGTCGGTGACCAAGTCCATCAAGGCCGGGCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCTCAAGAAGGGCCGCTAC
GCCCAGCGCGTCGGCTCCGGCGCCCCCGTCTACCTCGCCGCCGTCCTCGAGTACCTCGCAGCAGAGGTGCTGGAGCTGGCCGGGAACGCCGCCAAGGACA
ACAAGAAGAGCCGCATCGTGCCCAGGCACCTGCTGCTGGCCATCCGCAACGACCAGGAGCTCGGGAGGCTGCTGTCCGGCGTCACCATCGCCCACGGCGG
CGTCATCCCCAACATCAACCCGGTGCTGCTCCCCAAGAAGGCCGCCGAGAAGGCTGAGAAGGCCGAGAAGACCGCCACCAAGTCGCCCAAGAAGGCCACC
AAGTCCCCCAAGAAGGCCACCAAGGCGTAGATCTGGCTCCGAGCGCCCGTGCCGGTGAACTGGACTGATGGTGCTCCGTCAGCCCTCGTGTGCCTAGTGT
CTCTGTGTTAAGTTAGCTGTGGTGTGTTCCAGAGTGTGTTGAAGCTTGTTCTTTTGCTTTGCCCCGCCATGTAACCGTGAACGAAGAGGAAGCGTCTTGC
TTCCTCTGTTCTGCTATATCAATCTGGTTTCTAATGCAGTGTTTGTTAAAAAAAAAA
page-top