Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1755
Contig Information
Length 820 bp
Tissue Callus
Clones 4 Clones [Download: CSV  ,  FASTA ]
whcs10e04    whcs10e15    rwhcs10e04    rwhcs10e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_017872 [Oryza sativa (japonica cultivar-group)]
Score 571
Evalue 6.37723e-57
Total Hit Count 25
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1755
ACGAGGATCAGTTAGTCAGCTGCCCACACAGATGGAGGGCAACTTGCCTCCAGGGATAAGGGATCGTGTCTTTTACCTGGAAGGAGATCACATGCATTCT
AGTATCCAGAAGGTTCCTGCTCTGGTCTTGGATTGTGAACCTGACATTGATTTCAACAGAGACATACAAGCGAAACGACAGTACGCGCAGCAAGTTGCAG
AGTTCTTTGAATTCGTGAACAACAAAAAGGAAGCTCCATCCGAGCAAGCAAGCACTGAGAAGGACCGCATGAATCCAAAGATCATGTTCCCTAACAAAGG
AGGTTTGTGGGTCCCTGAAGGTGTGCCGCCTTTCGCGGGCTCTGCAATGAATCTGGATTTCAGAAGAGCCATGTCTTCATATCTCCCAACTTAAGGCCTC
AGCTTCGAGAGTACCCGGGCCTGTTTGGTTGAAGGCTAAGAATGCCATAATCATGCTAACTTTTTGTCGAAATCGTCTTATGGCCAAGGAAAAGGAGCCA
TAAGCACGACAAGCTTAGCTAAAAAGACCAGTGCCTGTGACAGACGGGTCATGAGGCTAAGCAGGTTGTGGCAAGCCATAGTTGTGGTAGGCAACCAAAC
ACAGGACCCTCAGCTCACTGACCTTGTAAAAATCGCTGATGCTTTTCACTAGACCTATTAGCTTTGCCTGATGCTAGCGGATGATGTAGAATAGTGTGTC
CGTGTCCCCATCTTGTAAATTGGCGATCTCGCTGGTAGTTTCACGTTCTGTGGTAGCAGTAGCCTATGTTTATCTGAACCATGGCGAGGACCTGTTTTGT
TGCTGGCTGCATTCTGTTCA
page-top