Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10a13
Contig Information
Length 128 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10a13   
Homology (BLAST) Top Hit triticain alpha [Triticum aestivum] (no hit)
Score 502
Evalue 3.27167e-49
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10a13
TCTGTCTTGAGATTACACAAAATGCTAGTTCAGAACAACACAAAGTCAACCTTCACGAACGAATTCACAATAGGGTACCAACAGTCATGGTTGGCTGGTT
AACTGGTGTACTCTTTTTTTTTTTTTNG
page-top