Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10d11
Contig Information
Length 669 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10d11   
Homology (BLAST) Top Hit density-regulated protein [Zea mays] >gi|195628138|gb|ACG35899.1| density-regulated protein [Zea mays]
Score 446
Evalue 1.34181e-42
Total Hit Count 247
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10d11
CACAGACTGTTCCTATGAAAGCAGACGAGACTGGAGCACTACTAATCTGCACTTATCTCTGCAGGTCCACGGATAGTTGGTACTGAATTGTTTTGAAACT
AGGATTCANAAGCACATTAAACCATATAAATCACATATGGATGTCATACTCGCCTTGCAGGAGGAACTCGACTATCAAATAAAAGATGATACACGAAGGC
GACGTGCCANCGGTAGTTAAAACACCACTTGTGAACTGACCCACAAGTCAAAATGGAGCGGGTTGTGTCTTGGGAGTAAGGATTAAGAACCCATGTGACA
GGCATGCCTTAACGGCCGTCTCTTGCCTTATATTTCTATCATATTTGTAACTCCACTGGTGTATGCCTTGTAAACCATATGTAATCAAGCAGCAGCAACC
TTCCTTCCATCTTCTATGAAATATACGGCGGATTCAGGAACATCAGGCCATGTAGCTGTAATGAAGTCCACAACATCATATGATATGTCTCCTTGGACAT
CAATTTGCTCCTTCTCAGTTGGGCCCTTGACAACCGAAGCTCCAGTAGCAAACTTCTTTCCAAGCTTCTTTGAAGCATCACTCAGCTTTACACCAAACAA
ATCCAGGCCTTTCACCACAGTAACACACTTGCGCTTGTTGCGGACAATCTTCTCAATAATAACCTCTTG
page-top