Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10e16
Contig Information
Length 664 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10e16   
Homology (BLAST) Top Hit Os02g0721700 [Oryza sativa (japonica cultivar-group)] >gi|45735979|dbj|BAD13008.1| unknown protein [Oryza sativa Japonica Group] >gi|113537493|dbj|BAF09876.1| Os02g0721700 [Oryza sativa (japonica cultivar-group)] >gi|215678963|dbj|BAG96393.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692557|dbj|BAG87977.1| unnamed protein product [Oryza sativa Japonica Group]
Score 574
Evalue 1.88712e-57
Total Hit Count 40
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10e16
TCTGACATAGCTTCAAATTACAAGATATTGCAAGAAGGAAAATTTCAAGAGCGCCTTAAGGAGCAGCAGCGGATTCAGGCTCAACATCATTTGAAAAACA
TGGAAGAAATAAAGGTATCACCACCACCACAACCACCTACTGGAAGAACAATGCTACTAGTCCACACATGAGAGTAATCAAAGCAAGCGAGCTGCTTCGA
GCCCTTTGGACACCACTTTTAACAACGTCTTTCTGGGGGACACCTTCGCAAGAAAGACCTAACTTGCCTTCTCGGCACTCGTGGGCAAACAGGCCTGGTG
GGTACTTGCCATAGAGGTTGATGTAGCTGAACATTGTGGATGCACAGTAATTGCTTTCATCATTGATGTAGTTATTAAACGGGCATGCAAATTCCTTGAA
AGAATCACAGCAGTCTTTAGGAGGATATTTCGGCCCTTTGCACCTGCTTGTGATGACGGTGTAGTTTTGGAACTCGAAGTTCACAGGACAATCCCTCTTG
GCCTGCAGCAAGGTCCTCCCCGTGGTAGATCCGGCGCTCGCCTGGAACACGCCGTCGGAGATGAAGGGGGAAGCGGAGGCGAGCCCGACCAGGAGGGCGG
CGATGACGAGGAGGAGCGGGAGCCCACGGCCGGGCGGCCATCGCTCGTCCCTCCGCTCGGCGCC
page-top