Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp10g03
Contig Information
Length 185 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp10g03   
Homology (BLAST) Top Hit hypothetical protein OsI_19903 [Oryza sativa Indica Group]
Score 146
Evalue 3.59373e-08
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp10g03
AAAAACTGCTCCACGAACCAACCGGGGATGTACGACGGCCTATCNATCAGATCCAACGGCTATGCCGGCGGCGAGGTGAGGTGTGGTCCGGCCGCTTCAG
CCCTGCGACTCTATGGGCGACATCATCGCCGAGAACCGGCGCTTCTGGATGCGCGGGGGGAGGTGCTTGTTGTACCTCTTGGGCC
page-top