Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp11d05
Contig Information
Length 666 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp11d05   
Homology (BLAST) Top Hit hypothetical protein CHGG_05605 [Chaetomium globosum CBS 148.51] >gi|88181518|gb|EAQ88986.1| hypothetical protein CHGG_05605 [Chaetomium globosum CBS 148.51]
Score 95
Evalue 0.065921
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>whdp11d05
AGCTACTCGAACTACTCGGCTCCCGCCTACCAAGCCCCACAGCCAAGCTACTCAGCTCCAGCCATGACCACTTACGAGACCCAAAACTACACCGTCTCAT
CCTACCAGGCTCCATCCTACTCAGCCCCAAGCTACTCGGCCCCAGCCCCAAGCTACTCGGCCCCAGCCCCAAGCTACCCACAGCAAAGCTACTCCGCTCC
AGCCCCGAGCTACCCACAACAATCCTACAGCGCTCCAGCTGAGACCCCGGCTTACCAGCAGCCAAGCTACTCAGCCCCCGCTCCAAGCTACCCACAGCCA
CAACCCTCATACAGCGCCCCAGCTGAGCACCAGCAAAGCTACCAGGCCCCACAACAGAGCTACCAGCAGCCCCAACAACAATCCTACTCAGCCCCAGCTC
CAGCCGCCTACCCACAACCACAGGCTCCATCGTACCAGCCACAGCAGCCATCTTACCAGGCTCCTCAACCATCGTACCAGGCGCCAAGCTACTCGCAAGG
TTCTTACGCCAAGCGTAGCTACACTCACGACTCGGCTCCATACCAGATGTTGGTCGACCATTTGGCCGCCGCCAGCGACAAGGATGCCAGCTACACCAAC
ACCACCATCAAGTGCCCACCAAAGCCAAGCGACTACACTTGCCCAAAGGTTTTGGACCCAAAGAAC
page-top