Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhdp8m22
Contig Information
Length 661 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhdp8m22   
Homology (BLAST) Top Hit hypothetical protein OsJ_009336 [Oryza sativa (japonica cultivar-group)]
Score 669
Evalue 1.77938e-68
Total Hit Count 111
Registered year 2003
Contig Sequence     [ Download ]
>rwhdp8m22
GAAACTATTTACAGCTCGGCCCCAACATGCTACAANGTATCGCTGTGTCTAAATGGGCGCAGGCTTCATAAAATACAGCCCCCGCCCAGATCTCCTACAA
AAGGGACAAGAATCCCTTGGGAAAACATAAGCCTCTATACCGCCGATGGGAATTATGTGCACTTTCCGCATGCAAGCGATGTACTGTACTGTACTGCAGC
TCGACCGGCATCAAGGAAAAACAAGGGCTAGGATTCTGCTCTTTTGCCACGCGATTTCAAGCTTTTCTCCAAAAATGCCAGAGTCTCGGCGTATGAAGGG
TCATTCTTGTTCACCGGTTTACACGAGTTTATATGGTCAGTGTTCTGTAGAACAACAAGCTCCCCGTATCCTGGGTATGCAGATTCGATCGGGACTATCT
CCGCTCGGAATGCCCAACCACCATAACCTTCGACAATTGGTGTGACTTCGCTCTCACTAAAACTAAGAACATCGAGAAGTCCTTTGCTGTAGCGCTGCCG
CACAAAATCATTTAACTCAACAAGTCTTGGAGACCCACTTCTTAATTCGCCAATTGAAGGAGCTGGACGAAACACATAACCCATACGCCATGGCATGTCT
GCAAGTTTACTGCCAAAATGCGGACAGCTATAAAAGACTAGTCCAATTGTATTATTCAGGA
page-top