Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp11c17
Contig Information
Length 668 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp11c17   
Homology (BLAST) Top Hit Os06g0561200 [Oryza sativa (japonica cultivar-group)] >gi|53792789|dbj|BAD53823.1| putative Potassium-efflux system protein [Oryza sativa Japonica Group] >gi|113595912|dbj|BAF19786.1| Os06g0561200 [Oryza sativa (japonica cultivar-group)]
Score 872
Evalue 5.31461e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whdp11c17
ATTTCTCCTTTTTGCTCTAGGACTTGAGTTTTCTACCGCAAAACTACGAGCTGTACGCGCAGTTGCCGTTCTTGGAGGATTGCTGCAAATTATACTTTTT
ATGTTCCTTTGTGGTATTTCTGCGACGCTATGTGGGGGTAAAACAAAGGAAGGTGTTTTTGTTGGCGTTCTTCTTTCTATGTCTTCGACAGCAGTGGTTT
TAAAATTTTTGATGGAAAAAAATAGTATCAATGCACTTCATGGCCAAGTGACGGTTGGCATACTCGTATTGCAGGATTGTGCTGTTGGTCTTCTGTTTGC
ACTTCTTCCAATTTTGAGCGGCGCCTCTGGTCTTCTTCATGGAGTTGCGTCAATGACAAAATCGCTTGTGCTATTAATATCGTTCCTGGGAATTCTCTCT
ATCCTCTCCCGTACTTGCGTGCCTTGGTTTCTTAAGCTGATGATAAGTCTTTCGTCTCAGACAAATGAACTGTACCAGTTGGCAGCAGTTGCATTCTGCC
TGTTATTTGCTTGGTGCAGTGATAAATTGGGTCTGAGTCTTGAGTTGGGTTCATTTGCAGCTGGCGTTATGATATCAACAACCGATCTTGCTCAACATAC
TCTTGAACAAATTGAACCAATTCNAAATCTCTTTGCCGCCCTTTTCCTTGCCAGCATTGGGATGCTAA
page-top