Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10l12
Contig Information
Length 660 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10l12   
Homology (BLAST) Top Hit Os02g0266200 [Oryza sativa (japonica cultivar-group)] >gi|50251963|dbj|BAD27898.1| putative pentatricopeptide (PPR) repeat-containing protein [Oryza sativa Japonica Group] >gi|113536035|dbj|BAF08418.1| Os02g0266200 [Oryza sativa (japonica cultivar-group)] >gi|125581581|gb|EAZ22512.1| hypothetical protein OsJ_005995 [Oryza sativa (japonica cultivar-group)] >gi|215704610|dbj|BAG94238.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737116|dbj|BAG96045.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1038
Evalue 2.93175e-111
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whdp10l12
GCTGAGAAGGCGTTGGAGGTATTAATGATGAAAGTTGATCACTGGTTGGTAAGAGAGGTTATGAACACCGATGTTGGGGTCAGTGTGAAGATGCAATTTT
TCAGATGGGCAGCAAGGAAGAGGAATTACGAACACGACACATCCACTTACATGGCATTGATACGCTGTTTAGAGGTAGTAGAGCAGTATGGTGAAATGTG
GAAAATGATCCAAGAAATGGTACGGAATCCTGTATGTGTTGTCACGCCGATGGAGCTATCAGACATCATCCGGATGCTGGGAAATGCCAAGATGATCAGT
AAGGCAGTTGCAATCTTTTACCAAATCAAGGCACGAAAGTGTCAACCCACTGCTCAGGCATATAATAGCATGATAATCATGTTAATGCATGAGGGGGAGT
ATGAGAAAGTGCATGAACTTTACAATGAGATGAGCAACGAGGGCCAATGCTTCCCAGACACCGTGACTTACAGTGCGCTCATTTCTGCTTTCTGCAAACT
TGGTCGCCAGGATTCAGCAATTTGGTTGTTGAATGAGATGAAGGACAATGGAATGCAGCCAACTGCTAAGATATATACCATGCTAATGGCTTTGCTCTTT
AAATTGGACAATGTTCATGGAGCATTGAGTTTGTTTGAAGAGATGAGGCATCANTACTGC
page-top