Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whdp10l02
Contig Information
Length 615 bp
Tissue Seed DPA20
Clones 1 Clones [Download: CSV  ,  FASTA ]
whdp10l02   
Homology (BLAST) Top Hit hypothetical protein OsJ_004875 [Oryza sativa (japonica cultivar-group)]
Score 755
Evalue 1.62722e-78
Total Hit Count 210
Registered year 2003
Contig Sequence     [ Download ]
>whdp10l02
GATGGAAGCCGTCTCTGGGGTGATATGTTCACTATAACATATCAAAAGGCTGATAACGAAGTGGATAGGGAATCAACCAGAGGTTCATCTTTAGTGCTGA
AATCGTCCAAATCAGAACTTTGCAGAGCTACATCTCAAGAACAATGTACTTCTCTTCTTGATAGCATTTTGCAAGGAGAACTTCCTTGTGATATTGAGAA
ATCGACCCAAACTTATAATATTTTAGCACTATTGCGTGTATTGGAGGGATTGAATCAGCTATCTCCTCGTCTGAGACTACAGGCAACCTGTGATGATTTT
ATAGAGGGAAAAGTTGGTACCCTGGATGGGTTATATGGCACCGGAGCTAAGTTACCCTCAGAGGAGTTTATCAGCAGTAAGTTGACACCAAAGCTTGCTC
GGCAAATTCAGGATGTTCTTGCACTCTGCAGTGGTAGTTTACCTTCTTGGTGTTATCAGATGACCAAAGCTTGTCCATTTCTGTTTCCTTTTGAAACAAG
AAGACAACACTTCTACTCCACAGCTTTTGGGTTATCTAGGGCATTGAATCGTCTTCAGCAACAACAGGGTGATAATAATAGCTCANCGACTGAAAGAGAA
GTCCGGATTGGTANA
page-top